Creating Life In The Lab
DOWNLOAD
Download Creating Life In The Lab PDF/ePub or read online books in Mobi eBooks. Click Download or Read Online button to get Creating Life In The Lab book now. This website allows unlimited access to, at the time of writing, more than 1.5 million titles, including hundreds of thousands of titles in various foreign languages. If the content not found or just blank you must refresh this page
Creating Life In The Lab
DOWNLOAD
Author : Fazale Rana
language : en
Publisher: Baker Books
Release Date : 2011-02-01
Creating Life In The Lab written by Fazale Rana and has been published by Baker Books this book supported file pdf, txt, epub, kindle and other format this book has been release on 2011-02-01 with Religion categories.
Each year brings to light new scientific discoveries that have the power to either test our faith or strengthen it--most recently the news that scientists have created artificial life forms in the laboratory. If humans can create life, what does that mean for the creation story found in Scripture? Biochemist and Christian apologist Fazale Rana, for one, isn't worried. In Creating Life in the Lab, he details the fascinating quest for synthetic life and argues convincingly that when scientists succeed in creating life in the lab, they will unwittingly undermine the evolutionary explanation for the origin of life, demonstrating instead that undirected chemical processes cannot produce a living entity.
Laboratory Life
DOWNLOAD
Author : Bruno Latour
language : en
Publisher: Princeton University Press
Release Date : 2013-04-04
Laboratory Life written by Bruno Latour and has been published by Princeton University Press this book supported file pdf, txt, epub, kindle and other format this book has been release on 2013-04-04 with Social Science categories.
This highly original work presents laboratory science in a deliberately skeptical way: as an anthropological approach to the culture of the scientist. Drawing on recent work in literary criticism, the authors study how the social world of the laboratory produces papers and other "texts,"' and how the scientific vision of reality becomes that set of statements considered, for the time being, too expensive to change. The book is based on field work done by Bruno Latour in Roger Guillemin's laboratory at the Salk Institute and provides an important link between the sociology of modern sciences and laboratory studies in the history of science.
Lab Girl
DOWNLOAD
Author : Hope Jahren
language : en
Publisher: Hachette UK
Release Date : 2016-04-05
Lab Girl written by Hope Jahren and has been published by Hachette UK this book supported file pdf, txt, epub, kindle and other format this book has been release on 2016-04-05 with Biography & Autobiography categories.
Lab Girl is a book about work and about love, and the mountains that can be moved when those two things come together. It is told through Jahren's remarkable stories: about the discoveries she has made in her lab, as well as her struggle to get there; about her childhood playing in her father's laboratory; about how lab work became a sanctuary for both her heart and her hands; about Bill, the brilliant, wounded man who became her loyal colleague and best friend; about their field trips - sometimes authorised, sometimes very much not - that took them from the Midwest across the USA, to Norway and to Ireland, from the pale skies of North Pole to tropical Hawaii; and about her constant striving to do and be her best, and her unswerving dedication to her life's work. Visceral, intimate, gloriously candid and sometimes extremely funny, Jahren's descriptions of her work, her intense relationship with the plants, seeds and soil she studies, and her insights on nature enliven every page of this thrilling book. In Lab Girl, we see anew the complicated power of the natural world, and the power that can come from facing with bravery and conviction the challenge of discovering who you are.
Lab Dynamics
DOWNLOAD
Author : Carl M. Cohen
language : en
Publisher: CSHL Press
Release Date : 2005
Lab Dynamics written by Carl M. Cohen and has been published by CSHL Press this book supported file pdf, txt, epub, kindle and other format this book has been release on 2005 with Comportement organisationnel categories.
"Lab Dynamics is a book about the challenges to doing science and dealing with the individuals involved, including oneself. The authors, a scientist and a psychotherapist, draw on principles of group and behavioral psychology but speak to scientists in their own language about their own experiences. They offer in-depth, practical advice, real-life examples, and exercises tailored to scientific and technical workplaces on topics as diverse as conflict resolution, negotiation, dealing with supervision, working with competing peers, and making the transition from academia to industry." "This is a uniquely valuable contribution to the scientific literature, on a subject of direct importance to lab heads, postdocs, and students. It is also required reading for senior staff concerned about improving efficiency and effectiveness in academic and industrial research."--BOOK JACKET
The Grandest Challenge
DOWNLOAD
Author : Abdallah Daar
language : en
Publisher: Doubleday Canada
Release Date : 2011-09-20
The Grandest Challenge written by Abdallah Daar and has been published by Doubleday Canada this book supported file pdf, txt, epub, kindle and other format this book has been release on 2011-09-20 with Social Science categories.
The health-sciences equivalent of Thomas Friedman's bestseller The World is Flat, this inspiring and revelatory book by two of today's finest scientists shows how advances in global health will transform lives -- particularly in the developing world -- over the next decade. The Grandest Challenge begins with a simple premise: that every person's life is of equal value, regardless of where in the world he or she lives. It also begins with a simple, alarming fact: in this age of spectacular scientific advances, it is still those who live in the developed world -- in the West -- who benefit most from our enormous power to combat disease, and those in the developing world who are most likely to die for lack of basic, inexpensive care and nutrition. In this revelatory book, distinguished scientists Abdallah Daar and Peter Singer argue that the revolution in biotechnology can save millions of lives -- but only if we find a way to bring knowledge and treatments out of state-of-the-art labs and into the world's most remote villages. The doctors lead us on an eye-opening, globe-spanning tour, showing us in vivid detail how developing countries can and are breaking the cycle of dependence, exchanging knowledge, and creating solutions that work for their own people as well as the rest of us.
Designing Your Life
DOWNLOAD
Author : Bill Burnett
language : en
Publisher: Knopf
Release Date : 2016-09-20
Designing Your Life written by Bill Burnett and has been published by Knopf this book supported file pdf, txt, epub, kindle and other format this book has been release on 2016-09-20 with Self-Help categories.
#1 NEW YORK TIMES BEST SELLER • At last, a book that shows you how to build—design—a life you can thrive in, at any age or stage • “Life has questions. They have answers.” —The New York Times Designers create worlds and solve problems using design thinking. Look around your office or home—at the tablet or smartphone you may be holding or the chair you are sitting in. Everything in our lives was designed by someone. And every design starts with a problem that a designer or team of designers seeks to solve. In this book, Bill Burnett and Dave Evans show us how design thinking can help us create a life that is both meaningful and fulfilling, regardless of who or where we are, what we do or have done for a living, or how young or old we are. The same design thinking responsible for amazing technology, products, and spaces can be used to design and build your career and your life, a life of fulfillment and joy, constantly creative and productive, one that always holds the possibility of surprise.
Creation
DOWNLOAD
Author : Adam Rutherford
language : en
Publisher: Penguin UK
Release Date : 2013-04-04
Creation written by Adam Rutherford and has been published by Penguin UK this book supported file pdf, txt, epub, kindle and other format this book has been release on 2013-04-04 with Science categories.
'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Illustrated Guide To Home Biology Experiments
DOWNLOAD
Author : Robert Bruce Thompson
language : en
Publisher: Maker Media, Inc.
Release Date : 2012-04-17
Illustrated Guide To Home Biology Experiments written by Robert Bruce Thompson and has been published by Maker Media, Inc. this book supported file pdf, txt, epub, kindle and other format this book has been release on 2012-04-17 with Science categories.
Experience the magic of biology in your own home lab. This hands-on introduction includes more than 30 educational (and fun) experiments that help you explore this fascinating field on your own. Perfect for middle- and high-school students and DIY enthusiasts, this full-color guide teaches you the basics of biology lab work and shows you how to set up a safe lab at home. The Illustrated Guide to Home Biology Experiments is also written with the needs of homeschoolers firmly in mind, as well as adults who are eager to explore the science of nature as a life-long hobby. To get the most from the experiments, we recommend using this guide in conjunction with a standard biology text, such as the freely downloadable CK-12 Biology (ck-12.org). Master the use of the microscope, including sectioning and staining Build and observe microcosms, soda-bottle worlds of pond life Investigate the chemistry of life from simple acids, bases, and buffers to complex carbohydrates, proteins, lipids, enzymes, and DNA Extract, isolate, and observe DNA Explore photosynthesis, osmosis, nitrogen fixation, and other life processes Investigate the cell cycle (mitosis and cytokinesis) Observe populations and ecosystems, and perform air and water pollution tests Investigate genetics and inheritance Do hands-on microbiology, from simple culturing to micro-evolution of bacteria by forced selection Gain hands-on lab experience to prepare for the AP Biology exam Through their company, The Home Scientist, LLC (thehomescientist.com/biology), the authors also offer inexpensive custom kits that provide specialized equipment and supplies you’ll need to complete the experiments. Add a microscope and some common household items and you’re good to go.
Molecular Feminisms
DOWNLOAD
Author : Deboleena Roy
language : en
Publisher: University of Washington Press
Release Date : 2018-11-10
Molecular Feminisms written by Deboleena Roy and has been published by University of Washington Press this book supported file pdf, txt, epub, kindle and other format this book has been release on 2018-11-10 with Social Science categories.
�Should feminists clone?� �What do neurons think about?� �How can we learn from bacterial writing?� These provocative questions have haunted neuroscientist and molecular biologist Deboleena Roy since her early days of research when she was conducting experiments on an in vitro cell line using molecular biology techniques. An expert natural scientist as well as an intrepid feminist theorist, Roy takes seriously the expressive capabilities of biological �objects��such as bacteria and other human, nonhuman, organic, and inorganic actants�in order to better understand processes of becoming. She also suggests that renewed interest in matter and materiality in feminist theory must be accompanied by new feminist approaches that work with the everyday, nitty-gritty research methods and techniques in the natural sciences. By practicing science as feminism at the lab bench, Roy creates an interdisciplinary conversation between molecular biology, Deleuzian philosophies, science and technology studies, feminist theory, posthumanism, and postcolonial and decolonial studies. In Molecular Feminisms she brings insights from feminist and cultural theory together with lessons learned from the capabilities and techniques of bacteria, subcloning, and synthetic biology to o er tools for how we might approach nature anew. In the process she demonstrates that learning how to see the world around us is also always about learning how to encounter that world.
What Is Life
DOWNLOAD
Author : Edward Regis
language : en
Publisher: Oxford University Press, USA
Release Date : 2009
What Is Life written by Edward Regis and has been published by Oxford University Press, USA this book supported file pdf, txt, epub, kindle and other format this book has been release on 2009 with Science categories.
This book provides an introduction to the work of the scientists who were attempting literally to create life from scratch, starting with molecular components that they hope to assemble into the world's first synthetic living cell. The book also examines how scientists have unlocked the "three secrets of life," describes the key role played by ATP ("the ultimate driving force of all life"), and outlines the many attempts to explain how life first arose on earth, a puzzle that has given birth to a wide range of theories.