The Coming And Evolution Of Life
![The Coming And Evolution Of Life](https://ardhindie.com/assets/pdf.png)
DOWNLOAD
Download The Coming And Evolution Of Life PDF/ePub or read online books in Mobi eBooks. Click Download or Read Online button to get The Coming And Evolution Of Life book now. This website allows unlimited access to, at the time of writing, more than 1.5 million titles, including hundreds of thousands of titles in various foreign languages. If the content not found or just blank you must refresh this page
The Coming And Evolution Of Life
DOWNLOAD
Author : Henry Edward Crampton
language : en
Publisher:
Release Date : 1934
The Coming And Evolution Of Life written by Henry Edward Crampton and has been published by this book supported file pdf, txt, epub, kindle and other format this book has been release on 1934 with Biology categories.
A New History Of Life
DOWNLOAD
Author : Peter Ward
language : en
Publisher: Bloomsbury Publishing
Release Date : 2015-04-14
A New History Of Life written by Peter Ward and has been published by Bloomsbury Publishing this book supported file pdf, txt, epub, kindle and other format this book has been release on 2015-04-14 with Science categories.
An estimated 4.6 billion years ago, the Earth and Moon were formed in a violent impact. On this, many agree, and even more that a long time after that, life began. However, few know that the first life on the Earth may not have emerged on this planet, but could, in fact, have begun on Mars, brought here by meteorites. In this revolutionary book, leading scientists Peter Ward and Joe Kirschvink rewrite the principal account of the history of life on Earth. They show not only how the rise of animals was delayed for billions of years, but also what it was that first forced fish out of the sea and onto the land. Together, the two scientists explain how developments in the environment led to multiple Ice Ages before the emergence of dinosaurs and other giant animals, and what the true cause of these great beasts' eventual extinction was. Finally, charting the course of our own evolution, they explore whether this generation will see the end of the human species. A New History of Life proves not only that much of what we think we know should be unlearned, but also that the true history of life on Earth is much more surprising and wonderful than we could ever have imagined.
The Origins Of Life
DOWNLOAD
Author : John Maynard Smith
language : en
Publisher: OUP Oxford
Release Date : 2000-03-16
The Origins Of Life written by John Maynard Smith and has been published by OUP Oxford this book supported file pdf, txt, epub, kindle and other format this book has been release on 2000-03-16 with Science categories.
In this fascinating book, John Maynard Smith and Eors Szathmary present an original picture of evolution. They propose that during evolution there have been a number of major transitions in the way in which information is passed between generations. These transitions include the appearance of the first replicating molecules, the emergence of co-operative animal societies, and the unique language ability of humans. Containing many new ideas, this book is contemporary biology on the grandest scale, from the birth of life to the origin of language.
Mechanisms Of Life History Evolution
DOWNLOAD
Author : Thomas Flatt
language : en
Publisher: OUP Oxford
Release Date : 2011-05-12
Mechanisms Of Life History Evolution written by Thomas Flatt and has been published by OUP Oxford this book supported file pdf, txt, epub, kindle and other format this book has been release on 2011-05-12 with Science categories.
Life history theory seeks to explain the evolution of the major features of life cycles by analyzing the ecological factors that shape age-specific schedules of growth, reproduction, and survival and by investigating the trade-offs that constrain the evolution of these traits. Although life history theory has made enormous progress in explaining the diversity of life history strategies among species, it traditionally ignores the underlying proximate mechanisms. This novel book argues that many fundamental problems in life history evolution, including the nature of trade-offs, can only be fully resolved if we begin to integrate information on developmental, physiological, and genetic mechanisms into the classical life history framework. Each chapter is written by an established or up-and-coming leader in their respective field; they not only represent the state of the art but also offer fresh perspectives for future research. The text is divided into 7 sections that cover basic concepts (Part 1), the mechanisms that affect different parts of the life cycle (growth, development, and maturation; reproduction; and aging and somatic maintenance) (Parts 2-4), life history plasticity (Part 5), life history integration and trade-offs (Part 6), and concludes with a synthesis chapter written by a prominent leader in the field and an editorial postscript (Part 7).
The Coming Of Evolution The Story Of A Great Revolution In Science
DOWNLOAD
Author : John W. Judd
language : en
Publisher: Alpha Edition
Release Date : 2021-12-29
The Coming Of Evolution The Story Of A Great Revolution In Science written by John W. Judd and has been published by Alpha Edition this book supported file pdf, txt, epub, kindle and other format this book has been release on 2021-12-29 with categories.
The book "" The Coming of Evolution; The Story of a Great Revolution in Science "", has been considered important throughout the human history, and so that this work is never forgotten we have made efforts in its preservation by republishing this book in a modern format for present and future generations. This whole book has been reformatted, retyped and designed. These books are not made of scanned copies and hence the text is clear and readable.
The Coming Of Evolution
DOWNLOAD
Author : John W. Judd
language : en
Publisher:
Release Date : 2019-10-05
The Coming Of Evolution written by John W. Judd and has been published by this book supported file pdf, txt, epub, kindle and other format this book has been release on 2019-10-05 with categories.
John Wesley Judd (1840-1916) had a distinguished career, serving as both President of the Geological Society and Dean of the Royal College of Science. Before his retirement as Professor of Geology from Imperial College, he wrote this concise and accessible review of the beginnings of evolutionary theory. Judd skilfully examined the roots of an idea that, already by 1910, had profoundly influenced every branch of science and permeated the work of historians, politicians and theologians. His lively narrative introduces the key individuals, including Darwin and Lyell, who brought about this intellectual revolution. Judd analyses the principal influences that worked upon these scientists as well as the factors that permitted them to remain open to radical new views. His appreciation of the vision, courage and far-reaching impact of the work of both Lyell and Darwin, and the interplay between their ideas, is persuasively and eloquently expressed.
Creation
DOWNLOAD
Author : Adam Rutherford
language : en
Publisher: Penguin UK
Release Date : 2013-04-04
Creation written by Adam Rutherford and has been published by Penguin UK this book supported file pdf, txt, epub, kindle and other format this book has been release on 2013-04-04 with Science categories.
'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Evolution
DOWNLOAD
Author : Charles Devillers
language : en
Publisher: Springer Science & Business Media
Release Date : 2012-12-06
Evolution written by Charles Devillers and has been published by Springer Science & Business Media this book supported file pdf, txt, epub, kindle and other format this book has been release on 2012-12-06 with Science categories.
Is evolution predictible? Taking into account the results of such diverse disciplines of natural sciences as e. g. genetics embryology, ecology, palaeontology on the threshold of the coming century, the authors stretch out their ideas for discussing this question. Charles Devillers, biologist, and Jean Chaline, palaeontologist and geologist, developed a new assessment of the historic framework of evolution, based on their longterm experiences in scientific research, also including philosophical aspects to life. They aimed the book at a publicreceptive to problems of the origin and evolution of life and especially of mankind to teachers and scientists of various topics in the sciences of life, Earth and the Universe.
Pulse
DOWNLOAD
Author : Robert Frenay
language : en
Publisher: Farrar, Straus and Giroux
Release Date : 2006-04-04
Pulse written by Robert Frenay and has been published by Farrar, Straus and Giroux this book supported file pdf, txt, epub, kindle and other format this book has been release on 2006-04-04 with Nature categories.
Pulse is not about dance music, not about heart rates—and not about electromagnetic fields. What it does describe is a sea change in human affairs, a vast and fundamental shift that is about to transform every aspect of our lives. Written in lively prose for lay readers, Pulse shows how ideas that have shaped Western science, industry, and culture for centuries are being displaced by the rapid and dramatic rise of a "new biology"—by human systems and machines that work like living things. In Pulse, Robert Frenay details the coming world of • emotional computers • ships that swim like fish • hard, soft, and wet artificial life • money that mimics the energy flows in nature • evolution at warp speed And these are not blue-sky dreams. By using hundreds of vivid and concrete examples of cutting-edge work, Frenay showcases the brilliant innovations and often colorful personalities now giving birth to a radical new future. Along the way, he also offers thoughtful conclusions on the promises—and dangers—of our transformation to the next great phase of "human cultural evolution."
Story Of Life
DOWNLOAD
Author : Catherine Barr
language : en
Publisher: Frances Lincoln Children's Books
Release Date : 2018-02
Story Of Life written by Catherine Barr and has been published by Frances Lincoln Children's Books this book supported file pdf, txt, epub, kindle and other format this book has been release on 2018-02 with categories.
At first, nothing lived on Earth. It was a noisy, hot, scary place. Choking gas exploded from volcanoes and oceans of lava bubbled around the globe... Then in the deep, dark ocean, something amazing happened. This is an exciting and dramatic story about how life began and developed on Planet Earth, written especially for younger children. The authors explain how the first living cell was created, and how the cells multiply and create jellyfish and worms, and then fish with bendy necks, which drag themselves out of the water into swampy forests. They tell the story of the biggest creatures that have ever walked on land - the dinosaurs. Long after that, hairy creatures who have babies, not eggs, take over, stand on two legs and spread around the world, some of them living through cataclysmic events such as ice ages and volcanic eruptions. Everyone living today is related to these survivors. With delightful illustrations including lots of detail and humour, all carefully researched and checked, this book shows the development of life on Earth in a truly accessible and simple way. CLICK HERE to download Teachers' Notes specially written by the authors, Catherine Barr and Steve Williams, to assist teachers and librarians in the promotion and teaching of The Story of Lifein schools and to help foster a love of good books, literature and reading in children.