The Emergence Of Life
DOWNLOAD eBooks
Download The Emergence Of Life PDF/ePub or read online books in Mobi eBooks. Click Download or Read Online button to get The Emergence Of Life book now. This website allows unlimited access to, at the time of writing, more than 1.5 million titles, including hundreds of thousands of titles in various foreign languages. If the content not found or just blank you must refresh this page
The Emergence Of Life On Earth
DOWNLOAD eBooks
Author : Iris Fry
language : en
Publisher: Rutgers University Press
Release Date : 2000
The Emergence Of Life On Earth written by Iris Fry and has been published by Rutgers University Press this book supported file pdf, txt, epub, kindle and other format this book has been release on 2000 with Science categories.
How did life emerge on Earth? Is there life on other worlds? These questions, until recently confined to the pages of speculative essays and tabloid headlines, are now the subject of legitimate scientific research. This book presents a unique perspective--a combined historical, scientific, and philosophical analysis, which does justice to the complex nature of the subject. The book's first part offers an overview of the main ideas on the origin of life as they developed from antiquity until the twentieth century. The second, more detailed part of the book examines contemporary theories and major debates within the origin-of-life scientific community. Topics include: Aristotle and the Greek atomists' conceptions of the organism Alexander Oparin and J.B.S. Haldane's 1920s breakthrough papers Possible life on Mars?
The Emergence Of Life
DOWNLOAD eBooks
Author : Pier Luigi Luisi
language : en
Publisher: Cambridge University Press
Release Date : 2006-07-13
The Emergence Of Life written by Pier Luigi Luisi and has been published by Cambridge University Press this book supported file pdf, txt, epub, kindle and other format this book has been release on 2006-07-13 with Science categories.
The origin of life from inanimate matter has been the focus of much research for decades, both experimentally and philosophically. Luisi takes the reader through the consecutive stages from prebiotic chemistry to synthetic biology, uniquely combining both approaches. This book presents a systematic course discussing the successive stages of self-organisation, emergence, self-replication, autopoiesis, synthetic compartments and construction of cellular models, in order to demonstrate the spontaneous increase in complexity from inanimate matter to the first cellular life forms. A chapter is dedicated to each of these steps, using a number of synthetic and biological examples. With end-of-chapter review questions to aid reader comprehension, this book will appeal to graduate students and academics researching the origin of life and related areas such as evolutionary biology, biochemistry, molecular biology, biophysics and natural sciences.
The Emergence Of Life
DOWNLOAD eBooks
Author : P. L. Luisi
language : en
Publisher:
Release Date : 2006-07-13
The Emergence Of Life written by P. L. Luisi and has been published by this book supported file pdf, txt, epub, kindle and other format this book has been release on 2006-07-13 with Nature categories.
Uniquely combining biology and philosophy, this book offers a systematic course in the emergence of life from inanimate matter through to cellular life. With review questions included, this book will appeal to graduate students, academics and researchers in the field of the origin of life and other related areas.
The Origin Of Life
DOWNLOAD eBooks
Author : Paul Davies
language : en
Publisher: Penguin UK
Release Date : 2006-09-28
The Origin Of Life written by Paul Davies and has been published by Penguin UK this book supported file pdf, txt, epub, kindle and other format this book has been release on 2006-09-28 with Science categories.
The origins of life remains one of the great unsolved mysteries of science. Growing evidence suggests that the first organisms lived deep underground, in environments previously thought to be uninhabitable, and that microbes carried inside rocks have travelled between Earth and Mars. But the question remains: how can life spring into being from non-living chemicals? THE FIFTH MIRACLE reveals the remarkable new theories and discoveries that seem set to transform our understanding of life's role in the unfolding drama of the cosmos.
The Origin And Nature Of Life On Earth
DOWNLOAD eBooks
Author : Eric Smith
language : en
Publisher: Cambridge University Press
Release Date : 2016-03-31
The Origin And Nature Of Life On Earth written by Eric Smith and has been published by Cambridge University Press this book supported file pdf, txt, epub, kindle and other format this book has been release on 2016-03-31 with Science categories.
Uniting the foundations of physics and biology, this groundbreaking multidisciplinary and integrative book explores life as a planetary process.
The Origin Of Life
DOWNLOAD eBooks
Author : John Desmond Bernal
language : en
Publisher:
Release Date : 1967
The Origin Of Life written by John Desmond Bernal and has been published by this book supported file pdf, txt, epub, kindle and other format this book has been release on 1967 with Evolution categories.
Seven Clues To The Origin Of Life
DOWNLOAD eBooks
Author : Alexander Graham Cairns-Smith
language : en
Publisher: Cambridge University Press
Release Date : 1990-09-13
Seven Clues To The Origin Of Life written by Alexander Graham Cairns-Smith and has been published by Cambridge University Press this book supported file pdf, txt, epub, kindle and other format this book has been release on 1990-09-13 with Science categories.
The mysteries surrounding the origins of life on earth are written in detective story fashion by a world famous scientist in this popular version of Genetic Takeover, originally published in 1982.
The Origin Of Life On The Earth
DOWNLOAD eBooks
Author : Aleksandr Ivanovich Oparin
language : en
Publisher:
Release Date : 1957
The Origin Of Life On The Earth written by Aleksandr Ivanovich Oparin and has been published by this book supported file pdf, txt, epub, kindle and other format this book has been release on 1957 with Chemistry, Physical and theoretical categories.
Creation
DOWNLOAD eBooks
Author : Adam Rutherford
language : en
Publisher: Penguin UK
Release Date : 2013-04-04
Creation written by Adam Rutherford and has been published by Penguin UK this book supported file pdf, txt, epub, kindle and other format this book has been release on 2013-04-04 with Science categories.
'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
The Origins Of Life
DOWNLOAD eBooks
Author : John Maynard Smith
language : en
Publisher: OUP Oxford
Release Date : 2000-03-16
The Origins Of Life written by John Maynard Smith and has been published by OUP Oxford this book supported file pdf, txt, epub, kindle and other format this book has been release on 2000-03-16 with Science categories.
In this fascinating book, John Maynard Smith and Eors Szathmary present an original picture of evolution. They propose that during evolution there have been a number of major transitions in the way in which information is passed between generations. These transitions include the appearance of the first replicating molecules, the emergence of co-operative animal societies, and the unique language ability of humans. Containing many new ideas, this book is contemporary biology on the grandest scale, from the birth of life to the origin of language.